Home Contact Sitemap

eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine



   mowat-wilson syndrome
  

Disease ID 433
Disease mowat-wilson syndrome
Definition
A rare autosomal dominant syndrome caused by mutations in the ZEB2 gene. It is characterized by mental retardation, and a distinctive facial appearance (wide set eyes, uplifted earlobes, broad nasal bridge, prominent chin, and a smiling expression). The majority of patients have Hirschsprung disease (colonic enlargement and constipation due to intestinal blockage).
Synonym
hirschsprung disease mental retardation syndrome
hirschsprung disease-mental retardation syndrome
microcephaly, mental retardation and distinct features, with or without hirschsprung disease
microcephaly, mental retardation, and distinct facial features, with or without hirschsprung disease
mowat-wilson syndrome (disorder)
mows
Orphanet
OMIM
DOID
UMLS
C1856113
SNOMED-CT
Comorbidity
UMLS | Disease | Sentences' Count(Total Sentences:2)
C0014544  |  epilepsy  |  3
C0019569  |  hirschsprung's disease  |  2
Curated Gene
Entrez_id | Symbol | Resource(Total Genes:1)
9839  |  ZEB2  |  CLINVAR;CTD_human;UNIPROT
Inferring Gene(Waiting for update.)
Text Mined Gene
Entrez_id | Symbol | Score | Resource(Total Genes:36)
546  |  ATRX  |  1.317  |  DISEASES
64919  |  BCL11B  |  2.212  |  DISEASES
64115  |  C10orf54  |  1.777  |  DISEASES
6792  |  CDKL5  |  1.886  |  DISEASES
1108  |  CHD4  |  2.531  |  DISEASES
26047  |  CNTNAP2  |  1.628  |  DISEASES
129684  |  CNTNAP5  |  3.79  |  DISEASES
1910  |  EDNRB  |  4.142  |  DISEASES
79813  |  EHMT1  |  2.548  |  DISEASES
2290  |  FOXG1  |  2.77  |  DISEASES
2731  |  GLDC  |  2.599  |  DISEASES
79712  |  GTDC1  |  5.472  |  DISEASES
3065  |  HDAC1  |  1.059  |  DISEASES
23493  |  HEY2  |  2.132  |  DISEASES
3167  |  HMX2  |  2.817  |  DISEASES
3293  |  HSD17B3  |  2.57  |  DISEASES
152789  |  JAKMIP1  |  3.65  |  DISEASES
3785  |  KCNQ2  |  1.492  |  DISEASES
8242  |  KDM5C  |  2.502  |  DISEASES
4094  |  MAF  |  1.283  |  DISEASES
9935  |  MAFB  |  2.176  |  DISEASES
55777  |  MBD5  |  3.168  |  DISEASES
4204  |  MECP2  |  1.857  |  DISEASES
4205  |  MEF2A  |  2.701  |  DISEASES
4208  |  MEF2C  |  2.797  |  DISEASES
51199  |  NIN  |  2.349  |  DISEASES
114548  |  NLRP3  |  3.257  |  DISEASES
2516  |  NR5A1  |  1.517  |  DISEASES
5076  |  PAX2  |  1.35  |  DISEASES
256297  |  PTF1A  |  1.622  |  DISEASES
10479  |  SLC9A6  |  2.633  |  DISEASES
84679  |  SLC9A7  |  2.886  |  DISEASES
6663  |  SOX10  |  1.482  |  DISEASES
6938  |  TCF12  |  2.375  |  DISEASES
6925  |  TCF4  |  1.702  |  DISEASES
7337  |  UBE3A  |  2.466  |  DISEASES
Locus(Waiting for update.)
Disease ID 433
Disease mowat-wilson syndrome
Integrated Phenotype
HPO | Name(Total Integrated Phenotypes:50)
HP:0000639  |  Nystagmus
HP:0000028  |  Cryptorchidism
HP:0000568  |  Microphthalmia
HP:0000307  |  Pointed chin
HP:0004322  |  Short stature
HP:0001629  |  Ventricular septal defect
HP:0002119  |  Ventriculomegaly
HP:0002019  |  Constipation
HP:0002213  |  Fine hair
HP:0000358  |  Posteriorly rotated ears
HP:0002251  |  Aganglionic megacolon
HP:0000218  |  High palate
HP:0000232  |  Everted lower lip vermilion
HP:0010761  |  Broad columella
HP:0000086  |  Ectopic kidney
HP:0000047  |  Hypospadias
HP:0000490  |  Deeply set eye
HP:0007360  |  Aplasia/Hypoplasia of the cerebellum
HP:0006101  |  Finger syndactyly
HP:0007370  |  Aplasia/Hypoplasia of the corpus callosum
HP:0002007  |  Frontal bossing
HP:0000126  |  Hydronephrosis
HP:0002558  |  Supernumerary nipple
HP:0000486  |  Strabismus
HP:0002564  |  Malformation of the heart and great vessels
HP:0009748  |  Large earlobe
HP:0000316  |  Hypertelorism
HP:0000204  |  Cleft upper lip
HP:0001643  |  Patent ductus arteriosus
HP:0001636  |  Tetralogy of Fallot
HP:0002120  |  Cerebral cortical atrophy
HP:0000194  |  Open mouth
HP:0001869  |  Deep plantar creases
HP:0000048  |  Bifid scrotum
HP:0000076  |  Vesicoureteral reflux
HP:0000612  |  Iris coloboma
HP:0001250  |  Seizures
HP:0000286  |  Epicanthus
HP:0000175  |  Cleft palate
HP:0001822  |  Hallux valgus
HP:0000252  |  Microcephaly
HP:0001182  |  Tapered finger
HP:0000431  |  Wide nasal bridge
HP:0010059  |  Broad hallux phalanx
HP:0000348  |  High forehead
HP:0100490  |  Camptodactyly of finger
HP:0009909  |  Uplifted earlobe
HP:0001252  |  Muscular hypotonia
HP:0008572  |  External ear malformation
HP:0000534  |  Abnormality of the eyebrow
Text Mined Phenotype
HPO | Name | Sentences' Count(Total Phenotypes:1)
Disease ID 433
Disease mowat-wilson syndrome
Manually Symptom
UMLS  | Name(Total Manually Symptoms:1)
C0019570  |  hirschsprung's disease
Text Mined Symptom
UMLS | Name | Sentences' Count(Total Symptoms:1)
Manually Genotype(Total Manually Genotypes:1)
Gene Mutation DOI Article Title
ZEB2-doi:10.1038/gim.2015.51Clinical performance of the CytoScan Dx Assay in diagnosing developmental delay/intellectual disability
Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)
All Snps(Total Genotypes:78)
snpId pubmedId geneId geneSymbol diseaseId sourceId sentence score Year geneSymbol_dbSNP CHROMOSOME POS REF ALT
rs111724246NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404063GC,T
rs137852980NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399542TA
rs137852981NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399104GA
rs137852982NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398632GC
rs137852983NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389740TC
rs397515448NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389885AG
rs397515449NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389962TC
rs398124274NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399806GA
rs398124275NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399645-T,G
rs398124276NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399601G-
rs398124277NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399155A-
rs398124278NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399009-GAGT
rs398124280NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389732AGTACCCATTA
rs398124281NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404064TAGCCCCGGTCGCAGTA-
rs398124282NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144517276AG
rs398124283NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144403940CA-
rs398124284NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144403918GA
rs587776603NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400011TGTT-
rs587776604NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399761-T
rs587776605NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144403963-GT
rs587776606NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398734-A
rs587776607NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399295T-
rs587776608NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404874-CA
rs587776609NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389530-GG
rs587776611NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399325A-
rs587776612NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144517420CT
rs587784563NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399231GA
rs587784565NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398686T-
rs587784566NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398426GA
rs587784568NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404860CTGGCGTGCCAAGGCGAGA-
rs587784570NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144401292GC,A
rs587784571NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144401211GA
rs6711223NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400257GA,T
rs727503784NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144429811A-
rs727504223NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389563G-
rs727504224NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399311CT,A
rs727504226NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399969T-
rs727504228NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144429820CA
rs730881206NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144517292GA
rs730881208NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400190T-
rs730881209NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399268A-
rs730881211NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398958AG-
rs730881212NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144396477C-
rs730881213NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389900-T
rs730881215NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144429910TAGCTGGACTCGTAAC
rs730881216NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144390010CT
rs730881217NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144390023T-
rs730881218NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389597T-
rs756686919NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400207GC
rs786200997NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144429795-T
rs786204801NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399930C-
rs786204802NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144517330-A
rs786204803NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399243G-
rs786204804NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398498-TG
rs786204805NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400005TGGTTCTGTTTCATTAATTTTAAGTCA
rs786204806NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404020C-
rs786204807NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399910AC
rs786204808NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399438GT
rs786204809NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399433A-
rs786204810NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399007AA-
rs786204811NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399303A-
rs786204812NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144429867AGAGCTT-
rs786204813NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144517277C-
rs786204814NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399767GCCTG-
rs786204815NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400160GA
rs786204816NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389696CATCCCTCGG-
rs786204817NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404968C-
rs786204818NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399220AT-
rs786204819NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399500T-
rs786204820NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399534G-
rs786204821NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399007AAAG-
rs794727924NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398486GA
rs797046117NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144400081AT
rs797046118NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144399126A-
rs797046119NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144398780GAGT-
rs797046120NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144396585AT
rs797046121NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144389959GT
rs797046122NA9839ZEB2umls:C1856113CLINVARNA0.447600372NAZEB22144404049GT
GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)
GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)
Mapped by lexical matching(Total Items:23)
HP ID HP Name MP ID MP Name Annotation
HP:0000431Wide nasal bridgeMP:0006292abnormal nasal placode morphologyany structural anomaly in the paired ectodermal placodes that come to lie in the bottom of the olfactory pits as the pits are deepened by the growth of the surrounding medial and lateral nasal processes; the nasal placode gives rise to the olfactory epith
HP:0001643Patent ductus arteriosusMP:0011662persistent truncus arteriosus type iicomplete failure of the common arterial trunk opening out of both ventricles to divide into the aorta and pulmonary artery during development; type II is characterized by separate but proximate origins of the left and right pulmonary arterial branches fro
HP:0006101Finger syndactylyMP:0000564syndactylyany degree of webbing or fusion of the digits, may involve only soft tissues or also can include bone
HP:0002251Aganglionic megacolonMP:0002926aganglionic megacolonextreme dilation of the colon due to defects in innervation from the ganglia, or absence of the ganglia of the myenteric plexus
HP:0007360Aplasia/Hypoplasia of the cerebellumMP:0012129failure of blastocyst formationinability to form a blastocyst from a solid ball of cells known as a morula
HP:0000218High palateMP:0011615submucous cleft palatea cleft of the palate with cardinal signs including a bifid uvula, a V-shaped notch at the back of the hard palate, and/or a translucent line in the midline of the soft palate and a short palate
HP:0001636Tetralogy of FallotMP:0011665d-loop transposition of the great arteriescomplete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th
HP:0001252Muscular hypotoniaMP:0004144hypotoniadecreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness
HP:0000086Ectopic kidneyMP:0011441decreased kidney cell proliferationdecrease in the expansion rate of any kidney cell population by cell division
HP:0000175Cleft palateMP:0013550abnormal secondary palate morphology
HP:0000534Abnormality of the eyebrowMP:0010732abnormal node of Ranvier morphologyany structural anomaly of the short unmyelinated segments of an axon between myelinated segments, where voltage gated channels accumulate and regenerate an action potential as it is conducted along the axon
HP:0008572External ear malformationMP:0006286inner ear hypoplasiaunderdevelopment or reduced size of inner ear structures, usually due to decreased cell number
HP:0000048Bifid scrotumMP:0002670absent scrotummissing the external sac of skin that encloses the testes
HP:0000612Iris colobomaMP:0005262colobomaanomaly in which some of the structures of the eye are absent due to incomplete fusion of the fetal intraocular fissure during gestation
HP:0000490Deeply set eyeMP:0009829enlarged eye anterior chamberincreased size of the space in the eye, filled with aqueous humor, and bounded anteriorly by the cornea and a small portion of the sclera and posteriorly by a small portion of the ciliary body, the iris, and part of the crystalline lens
HP:0100490Camptodactyly of fingerMP:0020010decreased bone mineral density of femurreduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh
HP:0002213Fine hairMP:0010685abnormal hair follicle inner root sheath morphologyany structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a
HP:0000232Everted lower lip vermilionMP:0005170cleft upper lipdefect in the upper lip where the maxillary prominence fails to merge with the merged medial nasal prominences
HP:0002120Cerebral cortical atrophyMP:0012506brain atrophyacquired diminution of the size of the brain associated with wasting as from death and reabsorbtion of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal chan
HP:0000076Vesicoureteral refluxMP:0001948vesicoureteral refluxthe retrograde flow of urine from the bladder into the ureters and kidneys
HP:0001629Ventricular septal defectMP:0011667double outlet right ventricle with atrioventricular septal defecta form of DORV in which there is also a complete atrioventricular canal
HP:0007370Aplasia/Hypoplasia of the corpus callosumMP:0013283failure of ventral body wall closurefailure of the lateral body wall folds (a combination of mesoderm and ectoderm arising on each side of the embryo) to progress ventrally and meet in the midline and/or fuse to close the ventral body wall; normally, this closure is aided by growth of the h
HP:0000204Cleft upper lipMP:0005170cleft upper lipdefect in the upper lip where the maxillary prominence fails to merge with the merged medial nasal prominences
Mapped by homologous gene(Total Items:48)
HP ID HP Name MP ID MP Name Annotation
HP:0001252Muscular hypotoniaMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002120Cerebral cortical atrophyMP:0020329decreased capillary densityreduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0000048Bifid scrotumMP:0014198absent pituitary infundibular stalkabsence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland
HP:0001250SeizuresMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000486StrabismusMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002119VentriculomegalyMP:0020329decreased capillary densityreduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0002213Fine hairMP:0013897decreased eyelid cilium numberreduction in the number of the hairs that grow at the edge of the upper or lower eyelid
HP:0001629Ventricular septal defectMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0004322Short statureMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000316HypertelorismMP:0020321increased vascular endothelial cell apoptosisincrease in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000047HypospadiasMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0001182Tapered fingerMP:0014178increased brain apoptosisincrease in the number of cells of the brain undergoing programmed cell death
HP:0000126HydronephrosisMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0000490Deeply set eyeMP:0020157abnormal behavioral response to alcoholany anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior
HP:0008572External ear malformationMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000204Cleft upper lipMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000028CryptorchidismMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0007370Aplasia/Hypoplasia of the corpus callosumMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000076Vesicoureteral refluxMP:0014155absent olfactory epitheliumabsence of the epithelial cells that line the interior of the nose
HP:0000358Posteriorly rotated earsMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0010761Broad columellaMP:0013781abnormal mammary gland luminal epithelium morphologyany structural anomaly of the inner cell layer of the mammary epithelium bilayer that lines the luminal surface of mammary gland ducts and alveoli; luminal cells have only limited contact with the underlying basement membrane and surrounding connective ti
HP:0007360Aplasia/Hypoplasia of the cerebellumMP:0020039increased bone ossificationincrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance
HP:0002251Aganglionic megacolonMP:0020220decreased tear productiondecreased production of the amount of fluid produced in the eye
HP:0001643Patent ductus arteriosusMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0006101Finger syndactylyMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0100490Camptodactyly of fingerMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000086Ectopic kidneyMP:0014164abnormal ciliary process morphology any structural anomaly of any of the pigmented processes that radiate from the ciliary muscle and give attachments to ligaments supporting the lens of the eye; these processes increase in thickness as they advance from the orbiculus ciliaris to the exter
HP:0002558Supernumerary nippleMP:0013550abnormal secondary palate morphology
HP:0001636Tetralogy of FallotMP:0014117increased pancreatic beta cell apoptosisincrease in the number of pancreatic beta cells undergoing programmed cell death
HP:0000612Iris colobomaMP:0013791absent external naresabsence or failure to form both of the anterior openings to the nasal cavity
HP:0000568MicrophthalmiaMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000194Open mouthMP:0020309increased creatine kinase activityincreased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0001822Hallux valgusMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0000348High foreheadMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0009748Large earlobeMP:0013781abnormal mammary gland luminal epithelium morphologyany structural anomaly of the inner cell layer of the mammary epithelium bilayer that lines the luminal surface of mammary gland ducts and alveoli; luminal cells have only limited contact with the underlying basement membrane and surrounding connective ti
HP:0000175Cleft palateMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000232Everted lower lip vermilionMP:0020157abnormal behavioral response to alcoholany anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior
HP:0000218High palateMP:0020321increased vascular endothelial cell apoptosisincrease in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000286EpicanthusMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0000639NystagmusMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0001869Deep plantar creasesMP:0012080chylous ascitesthe extravasation of milky triglyceride-rich chyle into the peritoneal cavity; often a secondary symptom of neoplasms
HP:0009909Uplifted earlobeMP:0020309increased creatine kinase activityincreased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0002019ConstipationMP:0020234decreased basal metabolismdecrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state
HP:0002007Frontal bossingMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000252MicrocephalyMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000431Wide nasal bridgeMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000534Abnormality of the eyebrowMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000307Pointed chinMP:0014178increased brain apoptosisincrease in the number of cells of the brain undergoing programmed cell death
Disease ID 433
Disease mowat-wilson syndrome
Case(Waiting for update.)